KIAA1637

Product ID	ORK06118
Accession No	AB046857
Description	nuclear receptor coactivator 5
Clone name	fj00747s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2753 bp) Predicted protein sequence (479 aa)
Source	Human fetal brain
Rouge ID	mKIAA1637 by Kazusa Mouse cDNA Project
Note	We replaced fj00747, former representative clones for KIAA1637 with fj00747s1. (2002/5/10)

Length: 2753 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1311 bp
Genome contig ID	gi51511747r_44023035
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TGAAATGATTACTTTTTAATTAAAATGAAAAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGCTTTGTTCATCTTTTTTGGGTGTGAATATGCTCTTTGCAGGATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	44123035	44132322	6	100.0	Perfect prediction

Length: 479 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCD5	3e-145	100.0	Nuclear recepto...	Homo sapiens
AAG36793	3.1e-145	100.0	nuclear recepto...	Homo sapiens
EAW75764	3.2e-145	100.0	nuclear recepto...	Homo sapiens
XP_514691	5.2e-145	99.8	nuclear recepto...	Pan troglodytes
XP_001108239	1.2e-144	99.6	similar to nucl...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004154	99	193	PF03129	Anticodon-binding

Primer_f	CAGGCTCTTGTTTTTGTCTAG
Primer_r	GAACCACAGCCAGAAACCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-