Gene/Protein Characteristic Table for KIAA1352
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01162
Accession No AB037773
Description leucyl-tRNA synthetase
Clone name fj01313
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3893 bp)
Predicted protein sequence (1212 aa)
Flexi ORF Clone FXC01162
Source Human fetal brain
Rouge ID mKIAA1352 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3893 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 195 bp
Genome contig ID gi51511721r_145373682
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGATTCCTGGACCTAATAAATTTTTTTTCCCTTTC
Flanking genome sequence
(99985 - 99936)
----+----*----+----*----+----*----+----*----+----*
TTTGGGTGTCCAAGAGAAATGGTTTTTGCCAAACTCTTTTTAAAAAACAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 r 145473667 145542416 32 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 1212 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9P2J5 0 100.0 Leucyl-tRNA syn...
Homo sapiens
BAG37619 0 99.8 unnamed protein...
Homo sapiens
BAA95667 0 99.7 leucyl tRNA syn...
Homo sapiens
XP_001157096 0 99.6 cytosolic leucy...
Pan troglodytes
XP_001156890 0 99.6 cytosolic leucy...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D21851 0.00016 26.4 KIAA0028
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR015413 737 791 PF09334 Aminoacyl-tRNA synthetase
IPR013155 830 966 PF08264 Valyl/Leucyl/Isoleucyl-tRNA synthetase
HMMTigr IPR004493 50 1098 TIGR00395 Leucyl-tRNA synthetase
ScanRegExp IPR001412 89 100 PS00178 Aminoacyl-tRNA synthetase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATGCTGTTTTCAATGTGGACC
Primer_r CCAATCAGTAGACACAATCAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp