KIAA1357

Product ID	ORK07590
Accession No	AB037778
Description	NHS-like 1
Clone name	fj01906
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4022 bp) Predicted protein sequence (836 aa)
Source	Human fetal brain
Rouge ID	mKIAA1357 by Kazusa Mouse cDNA Project

Length: 4022 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1509 bp
Genome contig ID	gi89161210r_138685401
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTTGTTAAATAAACTAGAGTATTGTCTTCTTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAGGACCTAGGATGACAATGCGGAGAGTCTTGGTCTGAATCTAGTGCG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	138785401	138794866	3	99.4	Perfect prediction

Length: 836 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW47916	6.9e-214	100.0	hCG18281, isofo...	Homo sapiens
NP_001137532	7e-214	100.0	NHS-like 1 [Hom...	Homo sapiens
Q5SYE7	7e-214	100.0	NHS-like protein 1.	Homo sapiens
XP_001095123	6e-203	95.6	similar to NHS-...	Macaca mulatta
XP_001095017	6e-203	95.6	similar to NHS-...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040955	0.00065	30.3	KIAA1522

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AACTGAAGTGATGGTGTGGAC
Primer_r	CCCATAGTTCTGTAGTGCAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-