KIAA1359

Gene/Protein Characteristic Table for KIAA1359

Order Kazusa clone(s) from :

Product ID	ORK06064
Accession No	AB037780
Description	mucin 20, cell surface associated
Clone name	fj02042
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3550 bp) Predicted protein sequence (517 aa)
Source	Human fetal brain

Length: 3550 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	202 bp
Genome contig ID	gi89161205f_196835382
PolyA signal sequence (AAGAAA,-28)	+--------+--------+----*----+---- AGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGG
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	196935382	197031160	4	98.5	Terminal No-hit

Features of the protein sequence

Description

Length: 517 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD06720	1.7e-142	99.0	transmembrane m...	Homo sapiens
Q8N307	1.4e-103	80.7	Mucin-20; Short...	Homo sapiens
CAH89437	3.3e-86	85.3	hypothetical pr...	Pongo abelii
NP_001091986	9.4e-84	88.3	mucin 20 isofor...	Homo sapiens
NP_689886	1e-83	88.0	mucin 20 isofor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79992	0.00047	25.0	KIAA0170
AB002307	0.00065	25.9	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ACTTCACCCCTTCAGAGACAC
Primer_r	TGCTGTTGGTTGTAGTCGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 3

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACTTCACCCCTTCAGAGACAC
Primer_r	TGCTGTTGGTTGTAGTCGGAG
PCR product length	105 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp