KIAA1576

Product ID	ORK00867
Accession No	AB046796
Description	vesicle amine transport 1-like
Clone name	fj02237
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3760 bp) Predicted protein sequence (448 aa)
HaloTag ORF Clone	FHC00867
Flexi ORF Clone	FXC00867
Source	Human fetal brain
Rouge ID	mKIAA1576 by Kazusa Mouse cDNA Project

Length: 3760 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2411 bp
Genome contig ID	gi51511732f_76279992
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AAATATAAATAAAGTATTCAGCATAGCAAAACCTC
Flanking genome sequence (291514 - 291563)	----+--------+--------+--------+--------+----* ACCTGGCATCTGCTATTCCACATAATTCATTGCTGGATAAGCAGTCGCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	76379992	76571504	9	99.3	Perfect prediction

Length: 448 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001105796	7.7e-150	98.4	similar to Syna...	Macaca mulatta
XP_852661	4.3e-145	96.2	similar to Syna...	Canis lupus fam...
BAF82842	2.3e-141	99.8	unnamed protein...	Homo sapiens
CAH93436	4.2e-140	98.8	hypothetical pr...	Pongo abelii
AAI14122	2e-138	97.4	Hypothetical pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013154	97	178	PF08240	Alcohol dehydrogenase GroES-like
HMMPfam	IPR013149	209	365	PF00107	Alcohol dehydrogenase
ScanRegExp	IPR002364	210	231	PS01162	Quinone oxidoreductase/zeta-crystallin

Primer_f	AGTGGCATTCCTAGTAAGTTG
Primer_r	TCGTCTGGACATAACAAAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-