Gene/Protein Characteristic Table for KIAA1432
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05660
Accession No AB037853
Description RAB6A GEF complex partner 1
Clone name fj02309
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4961 bp)
Predicted protein sequence (796 aa)
Flexi ORF Clone FXC05660
Source Human fetal brain
Rouge ID mKIAA1432 by Kazusa Mouse cDNA Project
Note We replaced fj00670, former representative clones for KIAA1432 with fj02309. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4961 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2570 bp
Genome contig ID gi89161216f_5647341
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TCTCCCCTTGGTAAAGGGCAATAAAACCATTACAC
Flanking genome sequence
(119215 - 119264)
----+----*----+----*----+----*----+----*----+----*
AAACTTTGGTTTATTCATCATCTCAGGTTAACAGCCACGAAAATCATCTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 9 f 5747341 5766554 11 99.5 Internal No-hit
Features of the protein sequence
Description

Length: 796 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI44297 0 100.0 Unknown (protei...
Homo sapiens
Q4ADV7 0 100.0 Protein RIC1 ho...
Homo sapiens
XP_520477 0 99.6 hypothetical pr...
Pan troglodytes
XP_001108907 0 98.7 similar to CG90...
Macaca mulatta
XP_001492194 0 96.6 similar to Prot...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR009771 104 377 PF07064 Protein of unknown function DUF1339
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGCTACCCTTCTATTCAACAC
Primer_r ACTGGGATAAACTGATGCTTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp