KIAA1360

Product ID	ORK00814
Accession No	AB037781
Description	SCY1-like 2 (S. cerevisiae)
Clone name	fj02325
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4944 bp) Predicted protein sequence (796 aa)
Flexi ORF Clone	FXC00814
Source	Human fetal brain

Length: 4944 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2551 bp
Genome contig ID	gi89161190f_99116039
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- ACCAAATAAATTTTAGCTTTGATAAAACTTTCCAT
Flanking genome sequence (143595 - 143644)	----+--------+--------+--------+--------+----* ATTAAGTTGTGATTTCATACTTTGTGATTACTGGTCTTAAAATAATTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	99216031	99259632	15	99.7	Terminal No-hit

Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72436	100.0	SCY1-like 2 [sy...	synthetic construct
XP_001153388	99.2	SCY1-like 2 pro...	Pan troglodytes
XP_001089605	98.7	similar to SCY1...	Macaca mulatta
Q6P3W7	99.0	SCY1-like prote...	Homo sapiens
XP_001153456	98.7	SCY1-like 2 pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	11	187	PD000001	Protein kinase
HMMPfam	IPR000719	93	190	PF00069	Protein kinase
HMMPfam	IPR000357	310	346	PF02985	HEAT
HMMSmart	IPR002290	2	190	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	190	PS50011	Protein kinase

Primer_f	GGTCTGCCTCAAATAGTAATG
Primer_r	AAGGTAGTAGTCAGGGAAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-