|
Order Kazusa clone(s) from : |
| Product ID | ORK05985 |
|---|---|
| Accession No | AB037785 |
| Description | microtubule associated monooxygenase, calponin and LIM domain containing 3 |
| Clone name | fj02442 |
| Vector information | |
| cDNA sequence | DNA sequence (4261 bp) Predicted protein sequence (811 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1364
by Kazusa Mouse cDNA Project
|
Length: 4261 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 22 | r | 16702717 | 16765490 | 18 | 100.0 | Perfect prediction |
Length: 811 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001781 | 627 | 681 | PD000094 | Zinc finger |
| HMMPfam | IPR001715 | 354 | 459 | PF00307 | Calponin-like actin-binding |
| IPR001781 | 627 | 686 | PF00412 | Zinc finger | |
| HMMSmart | IPR001715 | 355 | 454 | SM00033 | Calponin-like actin-binding |
| IPR001781 | 626 | 680 | SM00132 | Zinc finger | |
| ProfileScan | IPR001715 | 353 | 456 | PS50021 | Calponin-like actin-binding |
| IPR001781 | 625 | 687 | PS50023 | Zinc finger | |
| ScanRegExp | IPR001781 | 627 | 661 | PS00478 | Zinc finger |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | ACCTCAGCCCTCATGTCAGAC |
|---|---|
| Primer_r | CATCAGTGACAGCTTTGGAAC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 22
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | ACCTCAGCCCTCATGTCAGAC |
| Primer_r | CATCAGTGACAGCTTTGGAAC |
| PCR product length | 127 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |