KIAA1472

Product ID	ORK07034
Accession No	AB040905
Description	syntabulin (syntaxin-interacting)
Clone name	fj03211
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2528 bp) Predicted protein sequence (601 aa)
Source	Human fetal brain
Rouge ID	mKIAA1472 by Kazusa Mouse cDNA Project

Length: 2528 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	720 bp
Genome contig ID	gi51511724r_110555591
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTGTTTCCATTTAAATAAATGTTTTATCCTCCCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATAATAATTATTTCTGTGATTTTACTTCTATGTATAAGAAAGACAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	110655591	110724177	6	100.0	Perfect prediction

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD72979	3e-202	100.0	Golgi-localized...	Homo sapiens
BAD72976	3e-202	100.0	Golgi-localized...	Homo sapiens
Q9NX95	3e-202	100.0	Syntabulin; Syn...	Homo sapiens
CAD28457	3e-202	100.0	hypothetical pr...	Homo sapiens
EAW91936	3.1e-202	100.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002372	1.6e-25	41.8	KIAA0374

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	544	SFLVDLLAVAAPVVPTVLWAFST	566	PRIMARY	23
SOSUI2	2	571	TDPVYNIGALLRGCCVVALHSL	592	SECONDARY	22

Primer_f	CATGTTATCTCCTTGCTTTGC
Primer_r	CCAAGTAAGACAGTAAAGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-