KIAA1978

Product ID	ORK05739
Accession No	AB075858
Description	ribonucleoprotein, PTB-binding 1
Clone name	fj03313
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4694 bp) Predicted protein sequence (384 aa)
Source	Human fetal brain
Rouge ID	mKIAA1978 by Kazusa Mouse cDNA Project

Length: 4694 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3365 bp
Genome contig ID	gi42406306r_10187891
PolyA signal sequence (ATTAAA,-30)	+--------+--------+----*----+---- GCTGAATTAAAGTTTGTAAGTAAATGGTTTTAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCAGAGTTGGCTGGTTCTTGGGACAAACAGTGGGCTTGAGTGGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	10287891	10305187	10	99.3	Perfect prediction

Length: 384 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IY67	4.1e-109	81.3	Ribonucleoprote...	Homo sapiens
NP_597709	4.8e-109	89.4	RAVER1 [Homo sa...	Homo sapiens
EAW84094	5.5e-109	89.4	hCG2033729, iso...	Homo sapiens
XP_001105380	1.8e-107	88.3	similar to Rave...	Macaca mulatta
AAI23486	9.8e-105	81.4	RAVER1 protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046799	1e-46	49.9	KIAA1579

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	55	126	PF00076	RNA recognition motif
HMMPfam	IPR000504	178	215	PF00076	RNA recognition motif
HMMSmart	IPR000504	54	127	SM00360	RNA recognition motif
HMMSmart	IPR000504	143	216	SM00360	RNA recognition motif
ProfileScan	IPR000504	53	131	PS50102	RNA recognition motif

Primer_f	CCTCATTATGTCTCTGGCTTG
Primer_r	CTCGAAAGGCCAAAATTACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-