KIAA1371

Product ID	ORK05635
Accession No	AB037792
Description	KIAA1109
Clone name	fj03325
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4096 bp) Predicted protein sequence (395 aa)
Source	Human fetal brain
Rouge ID	mKIAA1371 by Kazusa Mouse cDNA Project

Length: 4096 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2908 bp
Genome contig ID	gi89161207f_123249779
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TATTGACAATAAAGGAAACAGCTATACTTGGTGAT
Flanking genome sequence (118575 - 118624)	----+--------+--------+--------+--------+----* AAAAATTTTTTTTCTTATTATAAACACATTTCCAGGCTCCACAGAATTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	123349779	123368352	6	100.0	Perfect prediction

Length: 395 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_056127	4.2e-143	99.7	hypothetical pr...	Homo sapiens
XP_001102884	2.6e-142	98.8	similar to CG15...	Macaca mulatta
XP_517422	5.5e-142	99.1	similar to frag...	Pan troglodytes
BAC85988	9.1e-142	99.1	unnamed protein...	Homo sapiens
XP_540963	9.9e-142	98.3	similar to CG15...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	ACTCTGGACATGCCGTTTCTC
Primer_r	ACCATCTACTTTTTGCAACCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACTCTGGACATGCCGTTTCTC
Primer_r	ACCATCTACTTTTTGCAACCC
PCR product length	154 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles