KIAA1967

Gene/Protein Characteristic Table for KIAA1967

Order Kazusa clone(s) from :

Product ID	ORK05733
Accession No	AB075847
Description	cell cycle and apoptosis regulator 2
Clone name	fj04244
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3579 bp) Predicted protein sequence (818 aa)
Source	Human fetal brain
Rouge ID	mKIAA1967 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3579 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1067 bp
Genome contig ID	gi51511724f_22420366
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGGCTTGTTTTTTAAATAAACCAAAGTCAAAAAC
Flanking genome sequence (113562 - 113611)	----+--------+--------+--------+--------+----* AAACTGAGAGTGTGTCCTCCACAGCTCTTCCTACTCTCCTAGGCTTGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	22520135	22533926	17	99.6	Perfect prediction

Features of the protein sequence

Description

Length: 818 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAL38698	98.7	hypothetical pr...	synthetic construct
BAG53111	98.6	unnamed protein...	Homo sapiens
CAL37584	98.6	hypothetical pr...	synthetic construct
CAD38866	98.6	hypothetical pr...	Homo sapiens
XP_519650	98.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTTTTGCACCCCTAGAATGTC
Primer_r	GCTCTTCAATTCCGTTCACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 8

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp