KIAA2008

Product ID	ORK01642
Accession No	AB235153
Description	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B, transcript variant 3
Clone name	fj04470
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fj04470 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGT CGACCCACGC GTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4491 bp) Predicted protein sequence (793 aa)
HaloTag ORF Clone	FHC01642
Flexi ORF Clone	FXC01642
Source	Human fetal brain

Length: 4491 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1538 bp
Genome contig ID	gi51511734f_72276133
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATTTCTTGAAATAATAAATATTTTATTGGGATGTG
Flanking genome sequence (181923 - 181972)	----+--------+--------+--------+--------+----* AGGTGCAGAAGAGGAACTGTGCTGGATTCTCGTCTTTTCCTGCGGCATCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	72376133	72458054	17	99.5	Perfect prediction

Length: 793 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE44474	100.0	hypothetical pr...	Homo sapiens
Q3V5L5	100.0	Alpha-1,6-manno...	Homo sapiens
EAW89459	99.7	mannosyl (alpha...	Homo sapiens
EAW89457	99.7	mannosyl (alpha...	Homo sapiens
XP_001106632	98.1	similar to beta...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-