KIAA1376

Product ID	ORK00222
Accession No	AB037797
Description	arrestin domain containing 3
Clone name	fj04553
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4131 bp) Predicted protein sequence (437 aa)
HaloTag ORF Clone	FHC00222
Flexi ORF Clone	FXC00222
Source	Human fetal brain
Rouge ID	mKIAA1376 by Kazusa Mouse cDNA Project

Length: 4131 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2674 bp
Genome contig ID	gi51511721r_90600317
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- GAAAATAAAGTGTTTTGTTTTTTTCTGTTTTGTAT
Flanking genome sequence (99982 - 99933)	----+--------+--------+--------+--------+----* AATTGTTTGGAGATTTATTTGAATCTTGATCATATTAGTAACTCACCATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	90700299	90714877	8	100.0	Perfect prediction

Length: 437 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96B67	7e-185	100.0	Arrestin domain...	Homo sapiens
XP_001089534	1.3e-184	99.8	similar to arre...	Macaca mulatta
Q5R5L7	1.3e-184	99.8	Arrestin domain...	Pongo abelii
BAF84442	1.5e-184	99.8	unnamed protein...	Homo sapiens
XP_526859	1.5e-184	99.8	arrestin domain...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011021	32	188	PF00339	Arrestin-like
HMMPfam	IPR011022	210	337	PF02752	Arrestin-like

Primer_f	TTAATCTCAGGTGAACGCATC
Primer_r	TTCACTCCATTCTTAGCTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-