KIAA1579

Product ID	ORK06601
Accession No	AB046799
Description	ribonucleoprotein, PTB-binding 2
Clone name	fj04678
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4352 bp) Predicted protein sequence (704 aa)
Source	Human fetal brain

Length: 4352 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2237 bp
Genome contig ID	gi89161185f_64883366
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- AAATGAAATCTTAATATTAAAAGGCATATGCATGT
Flanking genome sequence (188136 - 188185)	----+--------+--------+--------+--------+----* AAAGTCTTTAGTATATTTATTTGTATAAAGAGTAAACAAAGTGCATATAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	64983366	65071500	12	99.5	Perfect prediction

Length: 704 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06549	0	100.0	hypothetical pr...	Homo sapiens
XP_001090029	0	94.3	similar to ribo...	Macaca mulatta
XP_600332	0	89.2	similar to ribo...	Bos taurus
EAX06550	7.5e-164	99.8	hypothetical pr...	Homo sapiens
XP_524729	1.7e-151	97.3	ribonucleoprote...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075858	6.6e-40	49.9	KIAA1978

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	97	161	PF00076	RNA recognition motif
	IPR000504	170	241	PF00076	RNA recognition motif
	IPR000504	299	330	PF00076	RNA recognition motif
HMMSmart	IPR000504	96	162	SM00360	RNA recognition motif
	IPR000504	169	242	SM00360	RNA recognition motif
	IPR000504	258	331	SM00360	RNA recognition motif
ProfileScan	IPR000504	95	166	PS50102	RNA recognition motif
	IPR000504	168	246	PS50102	RNA recognition motif
	IPR000504	257	335	PS50102	RNA recognition motif

Primer_f	CCACCAAAAGAAATTCGGCTC
Primer_r	AAGGTGGAGAATAAGCAATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-