KIAA1377

Product ID	ORK05657
Accession No	AB037798
Description	centrosomal protein 126kDa
Clone name	fj04709
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3916 bp) Predicted protein sequence (988 aa)
Source	Human fetal brain
Rouge ID	mKIAA1377 by Kazusa Mouse cDNA Project

Length: 3916 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	949 bp
Genome contig ID	gi51511727f_101223970
PolyA signal sequence (None)	+--------+--------+----*----+---- ACACCAGCCTGGGTGACAGTGTGAGACCCAGCCTC
Flanking genome sequence (150565 - 150614)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGTGATGAATCAAAATTAGAAATTAAGAGTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	101323970	101374533	8	99.4	Terminal No-hit

Length: 988 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG52970	99.8	unnamed protein...	Homo sapiens
XP_001150420	96.7	hypothetical pr...	Pan troglodytes
XP_508716	96.7	hypothetical pr...	Pan troglodytes
XP_001150291	96.6	hypothetical pr...	Pan troglodytes
BAG59033	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GTGAAGTTTAACAGAGCAGTG
Primer_r	CTCTACTCACAAGCTTCATCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 11

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTGAAGTTTAACAGAGCAGTG
Primer_r	CTCTACTCACAAGCTTCATCC
PCR product length	152 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles