Order Kazusa clone(s) from : ![]() |
Product ID | ORK01628 |
---|---|
Accession No | AB037800 |
Description | protein kinase C and casein kinase substrate in neurons 1, transcript variant 1 |
Clone name | fj05092s1 |
Vector information | |
cDNA sequence | DNA sequence (4214 bp) Predicted protein sequence (457 aa) |
HaloTag ORF Clone |
FHC01628
![]() |
Flexi ORF Clone | FXC01628 |
Source | Human fetal brain |
Rouge ID |
mKIAA1379
by Kazusa Mouse cDNA Project
|
Note | We replaced fj05092, former representative clones for KIAA1379 with fj05092s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2649 bp |
---|---|
Genome contig ID | gi89161210f_34441859 |
PolyA signal sequence (TATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (169077 - 169126) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 34541859 | 34610934 | 10 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 403 | 455 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 401 | 411 | PR00452 | Src homology-3 |
IPR001452 | 415 | 430 | PR00452 | Src homology-3 | |
IPR001452 | 445 | 457 | PR00452 | Src homology-3 | |
HMMPfam | IPR001060 | 30 | 118 | PF00611 | Cdc15/Fes/CIP4 |
IPR001452 | 401 | 457 | PF00018 | Src homology-3 | |
HMMSmart | IPR001060 | 30 | 118 | SM00055 | Cdc15/Fes/CIP4 |
IPR001452 | 401 | 457 | SM00326 | Src homology-3 | |
ProfileScan | IPR001060 | 26 | 89 | PS50133 | Cdc15/Fes/CIP4 |
IPR001452 | 398 | 457 | PS50002 | Src homology-3 |
![]() |
Primer_f | ATGACACGGGAGATGAACAGC |
---|---|
Primer_r | GTTGAGGTGCCGTTTGATGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |