KIAA1379

Product ID	ORK01628
Accession No	AB037800
Description	protein kinase C and casein kinase substrate in neurons 1, transcript variant 1
Clone name	fj05092s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4214 bp) Predicted protein sequence (457 aa)
HaloTag ORF Clone	FHC01628
Flexi ORF Clone	FXC01628
Source	Human fetal brain
Rouge ID	mKIAA1379 by Kazusa Mouse cDNA Project
Note	We replaced fj05092, former representative clones for KIAA1379 with fj05092s1. (2002/5/10)

Length: 4214 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2649 bp
Genome contig ID	gi89161210f_34441859
PolyA signal sequence (TATAAA,-26)	+--------+--------+----*----+---- TTAAAGGTATATAAATACAAATATATATATATATC
Flanking genome sequence (169077 - 169126)	----+--------+--------+--------+--------+----* AGTTGTGATTGTATGACTGTGGATAAAATCCAGAACTGTGTCAACCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	34541859	34610934	10	99.3	Perfect prediction

Length: 457 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BY11	4.9e-160	100.0	Protein kinase ...	Homo sapiens
Q5R411	1.4e-159	99.5	Protein kinase ...	Pongo abelii
CAH91500	3.9e-159	99.1	hypothetical pr...	Pongo abelii
XP_001116508	5.2e-157	98.6	protein kinase ...	Macaca mulatta
XP_850083	1.9e-156	96.8	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	403	455	PD000066	Src homology-3
FPrintScan	IPR001452	401	411	PR00452	Src homology-3
	IPR001452	415	430	PR00452	Src homology-3
	IPR001452	445	457	PR00452	Src homology-3
HMMPfam	IPR001060	30	118	PF00611	Cdc15/Fes/CIP4
HMMPfam	IPR001452	401	457	PF00018	Src homology-3
HMMSmart	IPR001060	30	118	SM00055	Cdc15/Fes/CIP4
HMMSmart	IPR001452	401	457	SM00326	Src homology-3
ProfileScan	IPR001060	26	89	PS50133	Cdc15/Fes/CIP4
ProfileScan	IPR001452	398	457	PS50002	Src homology-3

Primer_f	ATGACACGGGAGATGAACAGC
Primer_r	GTTGAGGTGCCGTTTGATGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-