Order Kazusa clone(s) from : ![]() |
Product ID | ORK00848 |
---|---|
Accession No | AB040915 |
Description | stromal interaction molecule 2 |
Clone name | fj06205 |
Vector information | |
cDNA sequence | DNA sequence (4841 bp) Predicted protein sequence (818 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1482
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2384 bp |
---|---|
Genome contig ID | gi89161207f_26371723 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (264380 - 264429) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 26471723 | 26636101 | 12 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011510 | 205 | 276 | PF07647 | Sterile alpha motif homology 2 |
ProfileScan | IPR001660 | 208 | 266 | PS50105 | Sterile alpha motif SAM |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 285 | NWMKDFILTVSIVIGVGGCWFA | 306 | PRIMARY | 22 |
---|
![]() |
Primer_f | CAGTTGGATGAATAGAGAAGG |
---|---|
Primer_r | ACAAACAATGCACATGCTCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |