KIAA1482

Product ID	ORK00848
Accession No	AB040915
Description	stromal interaction molecule 2
Clone name	fj06205
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4841 bp) Predicted protein sequence (818 aa)
Source	Human fetal brain
Rouge ID	mKIAA1482 by Kazusa Mouse cDNA Project

Length: 4841 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2384 bp
Genome contig ID	gi89161207f_26371723
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTCCTGATTTTAAAAGCAATATTTTCCTTACTGT
Flanking genome sequence (264380 - 264429)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGATCGATGATAGAAAAGTATAAAGAAGAAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	26471723	26636101	12	99.4	Perfect prediction

Length: 818 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_065911	100.0	stromal interac...	Homo sapiens
EAW92854	100.0	stromal interac...	Homo sapiens
XP_001166908	99.9	stromal interac...	Pan troglodytes
XP_001166846	98.9	stromal interac...	Pan troglodytes
AAI71766	98.8	Unknown (protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	205	276	PF07647	Sterile alpha motif homology 2
ProfileScan	IPR001660	208	266	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	285	NWMKDFILTVSIVIGVGGCWFA	306	PRIMARY	22

Primer_f	CAGTTGGATGAATAGAGAAGG
Primer_r	ACAAACAATGCACATGCTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-