KIAA1584

Product ID	ORK00250
Accession No	AB046804
Description	zinc finger protein 280D, transcript variant 2
Clone name	fj06751
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4306 bp) Predicted protein sequence (995 aa)
HaloTag ORF Clone	FHC00250
Flexi ORF Clone	FXC00250
Source	Human fetal brain
Rouge ID	mKIAA1584 by Kazusa Mouse cDNA Project

Length: 4306 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1317 bp
Genome contig ID	gi51511731r_54609671
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTGAGTAAATATTTGCAATAAAAATCTGCCCCCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATAATTCTATTTTTCCAATCACTGCTTGATTCAGATTACCTTTGGTGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	54709671	54812980	21	99.5	Perfect prediction

Length: 995 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW77504	99.9	suppressor of h...	Homo sapiens
CAE46003	99.9	hypothetical pr...	Homo sapiens
BAG58173	99.8	unnamed protein...	Homo sapiens
XP_001171708	99.6	suppressor of h...	Pan troglodytes
XP_001092359	97.8	similar to supp...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007930	5.9e-32	37.1	KIAA0461

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	434	457	PF00096	Zinc finger
HMMSmart	IPR015880	256	276	SM00355	Zinc finger
	IPR015880	337	359	SM00355	Zinc finger
	IPR015880	374	397	SM00355	Zinc finger
	IPR015880	404	427	SM00355	Zinc finger
	IPR015880	434	457	SM00355	Zinc finger
	IPR015880	463	485	SM00355	Zinc finger
	IPR015880	491	513	SM00355	Zinc finger
	IPR015880	660	683	SM00355	Zinc finger
	IPR015880	706	730	SM00355	Zinc finger
ProfileScan	IPR007087	374	402	PS50157	Zinc finger
ProfileScan	IPR007087	434	462	PS50157	Zinc finger
ScanRegExp	IPR007087	339	359	PS00028	Zinc finger
	IPR007087	376	397	PS00028	Zinc finger
	IPR007087	406	427	PS00028	Zinc finger
	IPR007087	465	485	PS00028	Zinc finger
	IPR007087	493	514	PS00028	Zinc finger

Primer_f	TGAGGATGATGCTGGTAAATG
Primer_r	GGCAGGCTAACACTTGTATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TGAGGATGATGCTGGTAAATG
Primer_r	GGCAGGCTAACACTTGTATGG
PCR product length	163 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles