KIAA1793

Product ID	ORK01181
Accession No	AB058696
Description	coiled-coil domain containing 136, transcript variant 1
Clone name	fj07087
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4168 bp) Predicted protein sequence (1270 aa)
HaloTag ORF Clone	FHC01181
Flexi ORF Clone	FXC01181
Source	Human fetal brain

Length: 4168 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	336 bp
Genome contig ID	gi89161213f_128119335
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CTGAGTTCCTTGTAATTAAATATCAACTGAATTAC
Flanking genome sequence (130086 - 130135)	----+--------+--------+--------+--------+----* ATGAGACTGTGGATTTTTATTTGCTAAATGCCTCACAACACAACCAGAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	128219335	128249419	18	99.9	Perfect prediction

Length: 1270 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JN2	100.0	Coiled-coil dom...	Homo sapiens
NP_073579	99.9	coiled-coil dom...	Homo sapiens
XP_001090156	97.3	similar to sarc...	Macaca mulatta
EAW83688	98.2	hypothetical pr...	Homo sapiens
XP_001502803	81.8	coiled-coil dom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046821	2.1e-06	31.0	KIAA1601
AB046785	0.00097	23.6	KIAA1565

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1245	PIFSLPLVGLVVISALLWCWWA	1266	PRIMARY	22

Primer_f	AGCAGCAGAGGATTCCGCAAC
Primer_r	CTGAGAGACCTAAACTACCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-