KIAA1794

Gene/Protein Characteristic Table for KIAA1794

Order Kazusa clone(s) from :

Product ID	ORK04982
Accession No	AB058697
Description	Fanconi anemia, complementation group I
Clone name	fj08520
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4671 bp) Predicted protein sequence (802 aa)
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 4671 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	670 bp
Genome contig ID	gi51511731f_87522915
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAGAATGCACTCTATAGAATAAATTCTCTTTAAAC
Flanking genome sequence (138450 - 138499)	----+--------+--------+--------+--------+----* ATTTCTTCTGTGGTTGAAGTAGGGGACAGGTACAGGTAGAATATTTGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	87622915	87661363	24	99.7	Perfect prediction

Features of the protein sequence

Description

Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
ABP88002	99.9	Fanconi anemia ...	Homo sapiens
AAI44484	99.8	Fanconi anemia,...	Homo sapiens
Q9NVI1	99.6	Fanconi anemia ...	Homo sapiens
XP_001166960	99.0	hypothetical pr...	Pan troglodytes
XP_001166767	94.5	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CCACCTCAAGAACTGTAACTG
Primer_r	CAGACCCTCCTAACATGTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 15

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp