KIAA1493

Gene/Protein Characteristic Table for KIAA1493

Order Kazusa clone(s) from :

Product ID	ORK04710
Accession No	AB040926
Description	doublecortin domain containing 5
Clone name	fj08657
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4768 bp) Predicted protein sequence (415 aa)
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 4768 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3445 bp
Genome contig ID	gi51511727r_30741730
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTTATTCAAAAACAATAAACCATGTAGATTTATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATGTGTGGGTGTGATTTTTGCATCTAGGAATCTTAAGTGGGAAAAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	30841730	30884840	11	99.2	Terminal No-hit

Features of the protein sequence

Description

Length: 415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW68253	2.5e-171	99.3	hCG1990724, iso...	Homo sapiens
AAI56060	1.8e-157	97.9	Doublecortin do...	synthetic construct
XP_508349	2.9e-157	97.7	hypothetical pr...	Pan troglodytes
EAW68252	3.4e-155	97.1	hCG1990724, iso...	Homo sapiens
XP_001086723	6.3e-150	93.2	similar to FLJ4...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003533	125	174	PF03607	Doublecortin

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CATCACTCTTCTTGTCTTGGC
Primer_r	CACATCAGCCCTCCAAATCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 11

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp