|
Order Kazusa clone(s) from : |
| Product ID | ORK00873 |
|---|---|
| Accession No | AB046809 |
| Description | zinc finger, FYVE domain containing 1, transcript variant 1 |
| Clone name | fj08951 |
| Vector information | |
| cDNA sequence | DNA sequence (4310 bp) Predicted protein sequence (816 aa) |
|
HaloTag ORF Clone |
FHC00873
|
| Flexi ORF Clone | FXC00873 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1589
by Kazusa Mouse cDNA Project
|
Length: 4310 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1430 bp |
|---|---|
| Genome contig ID | gi51511730r_72405913 |
| PolyA signal sequence (CATAAA,-19) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 14 | r | 72505913 | 72563498 | 12 | 99.8 | Perfect prediction |
Length: 816 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000306 | 632 | 699 | PF01363 | Zinc finger |
| IPR000306 | 749 | 815 | PF01363 | Zinc finger | |
| HMMSmart | IPR000306 | 629 | 699 | SM00064 | Zinc finger |
| IPR000306 | 746 | 815 | SM00064 | Zinc finger | |
| ProfileScan | IPR000306 | 637 | 698 | PS50178 | Zinc finger |
| IPR000306 | 754 | 814 | PS50178 | Zinc finger |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | AATCATGGGAAGGAAGGAGTG |
|---|---|
| Primer_r | GGAAGCAGATGTTTTGGGCAC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 14
Experimental conditions| Panel name | CCR |
|---|---|
| Primer_f | TTTAGGGAAGTATATGGCGGT |
| Primer_r | GGATGGTACACAGTTCTAGAG |
| PCR product length | 142 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |