|
Order Kazusa clone(s) from : |
| Product ID | ORK00252 |
|---|---|
| Accession No | AB046812 |
| Description | cyclin and CBS domain divalent metal cation transport mediator 4 |
| Clone name | fj09188 |
| Vector information | |
| cDNA sequence | DNA sequence (4510 bp) Predicted protein sequence (717 aa) |
|
HaloTag ORF Clone |
FHC00252
|
| Flexi ORF Clone | FXC00252 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1592
by Kazusa Mouse cDNA Project
|
Length: 4510 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2354 bp |
|---|---|
| Genome contig ID | gi89161199f_96690636 |
| PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (150701 - 150750) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 2 | f | 96790636 | 96841335 | 7 | 100.0 | Perfect prediction |
Length: 717 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR002550 | 126 | 300 | PF01595 | Protein of unknown function DUF21 |
| IPR000644 | 339 | 446 | PF00571 | Cystathionine beta-synthase | |
| ProfileScan | IPR000595 | 517 | 594 | PS50042 | Cyclic nucleotide-binding |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 127 | HILLITVLLVLSGIFSGLNLGLM | 149 | PRIMARY | 23 | 2 | 182 | NYLLCSLLLGNVLVNTSLTILLD | 204 | SECONDARY | 23 | 3 | 212 | MAVASSTIGIVIFGEILPQALCS | 234 | SECONDARY | 23 | 4 | 243 | NTILLTKFFMLLTFPLSFPISKL | 265 | SECONDARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | ACATCAAGATCACTCGGCAGC |
|---|---|
| Primer_r | TCGTTGAGAAGAGTTGTGGTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 2
Experimental conditions| Panel name | unigene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |