KIAA1979

Product ID	ORK05740
Accession No	AB075859
Description	Homo sapiens mRNA for KIAA1979 protein.
Clone name	fj09511
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5053 bp) Predicted protein sequence (309 aa)
Source	Human fetal brain

Length: 5053 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3652 bp
Genome contig ID	gi42406306f_58476614
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAACGTGAGACTTTTCATTTCAAAACAAAAGTC
Flanking genome sequence (105046 - 105095)	----+--------+--------+--------+--------+----* AAATGATGTAATTCCATAGAGTACCTTAATTTCTGTTTTTTGTTTTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	58576614	58581658	1	99.0	Perfect prediction

Length: 309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL20878	5.6e-57	50.0	mCG1029863 [Mus...	Mus musculus
AAH07307	1.3e-51	80.5	ZNF845 protein ...	Homo sapiens
EAW72132	1.7e-51	80.5	hCG2041454 [Hom...	Homo sapiens
Q96IR2	1.8e-51	80.5	Zinc finger pro...	Homo sapiens
NP_612383	1.8e-51	80.5	zinc finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB107355	3.5e-35	74.4	KIAA2033
AB075842	2.7e-29	54.2	KIAA1962
AB046831	5.2e-29	58.5	KIAA1611
AB051497	1.8e-28	58.1	KIAA1710
AB058732	3.5e-28	57.1	KIAA1829

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	15	38	PD000003	Zinc finger
	IPR007087	43	66	PD000003	Zinc finger
	IPR007087	71	94	PD000003	Zinc finger
	IPR007087	99	121	PD000003	Zinc finger
	IPR007087	127	150	PD000003	Zinc finger
HMMPfam	IPR007087	15	37	PF00096	Zinc finger
	IPR007087	43	65	PF00096	Zinc finger
	IPR007087	71	93	PF00096	Zinc finger
	IPR007087	99	121	PF00096	Zinc finger
HMMSmart	IPR015880	15	37	SM00355	Zinc finger
	IPR015880	43	65	SM00355	Zinc finger
	IPR015880	71	93	SM00355	Zinc finger
	IPR015880	99	121	SM00355	Zinc finger
	IPR015880	127	149	SM00355	Zinc finger
ProfileScan	IPR007087	15	42	PS50157	Zinc finger
	IPR007087	43	70	PS50157	Zinc finger
	IPR007087	71	98	PS50157	Zinc finger
	IPR007087	99	126	PS50157	Zinc finger
	IPR007087	127	154	PS50157	Zinc finger
ScanRegExp	IPR007087	17	37	PS00028	Zinc finger
	IPR007087	45	65	PS00028	Zinc finger
	IPR007087	73	93	PS00028	Zinc finger
	IPR007087	101	121	PS00028	Zinc finger

Primer_f	CTTCTTGCCACATCTTCTCAG
Primer_r	GGTAACGTGATTGTGATGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-