KIAA1600

Gene/Protein Characteristic Table for KIAA1600

Order Kazusa clone(s) from :

Product ID	ORK05678
Accession No	AB046820
Description	family with sequence similarity 160, member B1
Clone name	fj10035s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5401 bp) Predicted protein sequence (741 aa)
Source	Human fetal brain
Rouge ID	mKIAA1600 by Kazusa Mouse cDNA Project
Note	We replaced fj10035, former representative clones for KIAA1600 with fj10035s1. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 5401 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3173 bp
Genome contig ID	gi89161187f_116480626
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGGATGATCTAAAAAATAAATAATGTAATTTAAAC
Flanking genome sequence (133838 - 133887)	----+--------+--------+--------+--------+----* AAAACGTCTTATGTTTTTGTAAAATTCTAATTGGGAACATTTTATCCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	116580626	116614462	16	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 741 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5W0V3	100.0	UPF0518 protein...	Homo sapiens
CAI45992	99.6	hypothetical pr...	Homo sapiens
XP_508052	96.9	hypothetical pr...	Pan troglodytes
CAH70000	99.9	novel protein [...	Homo sapiens
AAH37207	99.7	FAM160B1 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GGACCAAAATTCTTAGCTCGC
Primer_r	TTCACTGTAACGTCTTCTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp