KIAA1602

Product ID	ORK05679
Accession No	AB046822
Description	NCK-associated protein 5-like
Clone name	fj10252
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4235 bp) Predicted protein sequence (1003 aa)
Source	Human fetal brain

Length: 4235 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1222 bp
Genome contig ID	gi89161190r_48371196
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CGTATCCCTAATAAAATGTGGAGGCCCCCTCCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCCCTGAGTCGGCTTGTTGTGTGGGAGGACTCAGGCAGGCCAGGTCGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	48471196	48477052	5	100.0	Perfect prediction

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001032895	98.9	hypothetical pr...	Homo sapiens
XP_001915643	90.1	hypothetical pr...	Equus caballus
XP_001926825	90.1	hypothetical pr...	Sus scrofa
XP_543680	89.9	hypothetical pr...	Canis lupus fam...
EAW58094	99.9	hCG1640179, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CTCCCCTTCCTTAGCATGTTC
Primer_r	AAACTTGAGACCCCTAGCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 12

Experimental conditions

Panel name	RH-map
Primer_f	CTCCCCTTCCTTAGCATGTTC
Primer_r	AAACTTGAGACCCCTAGCTGG
PCR product length	168 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles