|
Order Kazusa clone(s) from : |
| Product ID | ORK00875 |
|---|---|
| Accession No | AB046825 |
| Description | glucosidase, beta (bile acid) 2 |
| Clone name | fj10791 |
| Vector information | |
| cDNA sequence | DNA sequence (3757 bp) Predicted protein sequence (922 aa) |
|
HaloTag ORF Clone |
FHC00875
|
| Flexi ORF Clone | FXC00875 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1605
by Kazusa Mouse cDNA Project
|
Length: 3757 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 609 bp |
|---|---|
| Genome contig ID | gi89161216r_35626864 |
| PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 9 | r | 35726864 | 35739215 | 17 | 100.0 | Perfect prediction |
Length: 922 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR006775 | 566 | 915 | PF04685 | Protein of unknown function DUF608 |
| ScanRegExp | IPR002202 | 199 | 206 | PS00318 | Hydroxymethylglutaryl-coenzyme A reductase |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 831 | FELNVQAFAGGAMGAVNGMQPH | 852 | SECONDARY | 22 | 2 | 871 | YGLAATMIQELLPSGFCLWVIVI | 893 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TTACAACTATGACAGCAGCTC |
|---|---|
| Primer_r | GATAGTTTGGAGAGCACGGAC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 9
Experimental conditions| Panel name | unigene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |