Gene/Protein Characteristic Table for KIAA1609
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00876
Accession No AB046829
Description TBC/LysM-associated domain containing 1
Clone name fj11503
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4683 bp)
Predicted protein sequence (473 aa)
Flexi ORF Clone FXC00876
Source Human fetal brain
Rouge ID mKIAA1609 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4683 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 r 83067991 83095734 9 99.1 Internal No-hit
Features of the protein sequence
Description

Length: 473 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAF83926 1.7e-203 99.8 unnamed protein...
Homo sapiens
NP_065998 8e-203 99.3 hypothetical pr...
Homo sapiens
XP_001110946 4.4e-201 95.6 similar to CG51...
Macaca mulatta
BAG61921 1.2e-181 97.6 unnamed protein...
Homo sapiens
XP_546801 9e-162 78.2 similar to CG51...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006571 285 429 PF07534 TLDc
HMMSmart IPR006571 260 429 SM00584 TLDc

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 219 RVPHVAIFLSVVICKGFLVLCSS 241 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTTTCCACCCTGAGCTTGTTC
Primer_r TTGAGTGTCCAGAGGCAGAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp