Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00876 |
---|---|
Accession No | AB046829 |
Description | TBC/LysM-associated domain containing 1 |
Clone name | fj11503 |
Vector information | |
cDNA sequence | DNA sequence (4683 bp) Predicted protein sequence (473 aa) |
HaloTag ORF Clone |
FHC00876
|
Flexi ORF Clone | FXC00876 |
Source | Human fetal brain |
Rouge ID |
mKIAA1609
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 83067991 | 83095734 | 9 | 99.1 | Internal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006571 | 285 | 429 | PF07534 | TLDc |
HMMSmart | IPR006571 | 260 | 429 | SM00584 | TLDc |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 219 | RVPHVAIFLSVVICKGFLVLCSS | 241 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CTTTCCACCCTGAGCTTGTTC |
---|---|
Primer_r | TTGAGTGTCCAGAGGCAGAAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |