Gene/Protein Characteristic Table for KIAA1612
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00877
Accession No AB046832
Description 2-oxoglutarate and iron-dependent oxygenase domain containing 1
Clone name fj12771
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4550 bp)
Predicted protein sequence (550 aa)
Flexi ORF Clone FXC00877
Source Human fetal brain
Rouge ID mKIAA1612 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4550 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2897 bp
Genome contig ID gi51511732f_54943002
PolyA signal sequence
(GATAAA,-25)
+----*----+----*----+----*----+----
ACCTCTTTCAGATAAAAGCTATGATGTTCACCTGT
Flanking genome sequence
(127513 - 127562)
----+----*----+----*----+----*----+----*----+----*
AAAATATATGGTTTCTCTCTTTATTCTTAATAGTGAGTCTCCAATTCTTA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 55043002 55070513 13 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 550 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N543 0 100.0 2-oxoglutarate ...
Homo sapiens
BAB13967 0 99.8 unnamed protein...
Homo sapiens
BAB14226 0 99.6 unnamed protein...
Homo sapiens
Q5R4R3 0 97.8 2-oxoglutarate ...
Pongo abelii
XP_535297 4.6e-206 88.6 similar to CG31...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005123 145 247 PF03171 2OG-Fe(II) oxygenase
HMMSmart IPR006620 56 246 SM00702 Prolyl 4-hydroxylase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTACATCATCTACAGCAGCAC
Primer_r CCTAAGAGTTGTTGACATTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp