KIAA1612

Product ID	ORK00877
Accession No	AB046832
Description	2-oxoglutarate and iron-dependent oxygenase domain containing 1
Clone name	fj12771
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4550 bp) Predicted protein sequence (550 aa)
HaloTag ORF Clone	FHC00877
Flexi ORF Clone	FXC00877
Source	Human fetal brain
Rouge ID	mKIAA1612 by Kazusa Mouse cDNA Project

Length: 4550 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2897 bp
Genome contig ID	gi51511732f_54943002
PolyA signal sequence (GATAAA,-25)	+--------+--------+----*----+---- ACCTCTTTCAGATAAAAGCTATGATGTTCACCTGT
Flanking genome sequence (127513 - 127562)	----+--------+--------+--------+--------+----* AAAATATATGGTTTCTCTCTTTATTCTTAATAGTGAGTCTCCAATTCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	55043002	55070513	13	99.3	Perfect prediction

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N543	0	100.0	2-oxoglutarate ...	Homo sapiens
BAB13967	0	99.8	unnamed protein...	Homo sapiens
BAB14226	0	99.6	unnamed protein...	Homo sapiens
Q5R4R3	0	97.8	2-oxoglutarate ...	Pongo abelii
XP_535297	4.6e-206	88.6	similar to CG31...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005123	145	247	PF03171	2OG-Fe(II) oxygenase
HMMSmart	IPR006620	56	246	SM00702	Prolyl 4-hydroxylase

Primer_f	TTACATCATCTACAGCAGCAC
Primer_r	CCTAAGAGTTGTTGACATTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-