KIAA1952

Product ID	ORK07502
Accession No	AB075832
Description	zinc finger protein 618
Clone name	fj14047
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2894 bp) Predicted protein sequence (735 aa)
Source	Human fetal brain
Rouge ID	mKIAA1952 by Kazusa Mouse cDNA Project

Length: 2894 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	16 bp
Genome contig ID	gi89161216f_115730022
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAATCCAACATGCTTTAAGACTTGACTTCGGGGG
Flanking genome sequence (122264 - 122313)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAGAGAAGATAACATTAGAAAAAAACCACACAACACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	115830022	115852284	6	99.6	Perfect prediction

Length: 735 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5T7W0	1.7e-214	94.4	Zinc finger pro...	Homo sapiens
NP_588615	3.6e-214	95.5	zinc finger pro...	Homo sapiens
AAH53892	3.6e-214	95.5	Zinc finger pro...	Homo sapiens
XP_001145280	6.4e-214	94.3	zinc finger pro...	Pan troglodytes
XP_001097368	1.2e-213	94.2	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008906	654	734	PF05699	HAT dimerisation
ProfileScan	IPR007087	173	200	PS50157	Zinc finger
ScanRegExp	IPR007087	175	195	PS00028	Zinc finger

Primer_f	AACACCCAACAGCATGATCCC
Primer_r	CCCAGGATTTCAGTGACCGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-