|
Order Kazusa clone(s) from : |
| Product ID | ORK01639 |
|---|---|
| Accession No | AB067519 |
| Description | leukocyte receptor cluster (LRC) member 8 |
| Clone name | fj14525 |
| Vector information | |
| cDNA sequence | DNA sequence (3966 bp) Predicted protein sequence (795 aa) |
|
HaloTag ORF Clone |
FHC01639
|
| Flexi ORF Clone | FXC01639 |
| Source | Human fetal brain |
Length: 3966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 188 bp |
|---|---|
| Genome contig ID | gi42406306f_59558352 |
| PolyA signal sequence (ATTAAA,-25) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (106662 - 106711) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 19 | f | 59652214 | 59665012 | 16 | 99.6 | Terminal No-hit |
Length: 795 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CTATGGGCCACACACCTACAC |
|---|---|
| Primer_r | GGGTGGTAACAGCAAAGGGTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 19
Experimental conditions| Panel name | CCR |
|---|---|
| Primer_f | CTATGGGCCACACACCTACAC |
| Primer_r | GGGTGGTAACAGCAAAGGGTC |
| PCR product length | 134(400) bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |