KIAA1932

Gene/Protein Characteristic Table for KIAA1932

Order Kazusa clone(s) from :

Product ID	ORK01639
Accession No	AB067519
Description	leukocyte receptor cluster (LRC) member 8
Clone name	fj14525
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3966 bp) Predicted protein sequence (795 aa)
HaloTag ORF Clone	FHC01639
Flexi ORF Clone	FXC01639
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 3966 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	188 bp
Genome contig ID	gi42406306f_59558352
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- AGAAACCAAAATTAAAGAGAGAAAGAGAGAGCGTG
Flanking genome sequence (106662 - 106711)	----+--------+--------+--------+--------+----* CACGCTCCTGCTTTGTCTTTCCTGTGTGGGCTGTTTGCATCCATTGTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	59652214	59665012	16	99.6	Terminal No-hit

Features of the protein sequence

Description

Length: 795 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PV6	0	100.0	Leukocyte recep...	Homo sapiens
XP_001174961	0	99.4	leukocyte recep...	Pan troglodytes
XP_001174966	1.3e-215	98.6	leukocyte recep...	Pan troglodytes
XP_512894	2.8e-194	89.5	leukocyte recep...	Pan troglodytes
CAQ08956	7.8e-192	93.1	leukocyte recep...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005062	545	727	PF03399	SAC3/GANP/Nin1/mts3/eIF-3 p25

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTATGGGCCACACACCTACAC
Primer_r	GGGTGGTAACAGCAAAGGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 19

Experimental conditions

Panel name	CCR
Primer_f	CTATGGGCCACACACCTACAC
Primer_r	GGGTGGTAACAGCAAAGGGTC
PCR product length	134(400) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp