KIAA1700

Product ID	ORK04839
Accession No	AB051487
Description	dual specificity phosphatase 16
Clone name	fj15353
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4790 bp) Predicted protein sequence (690 aa)
Source	Human fetal brain

Length: 4790 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2609 bp
Genome contig ID	gi89161190r_12418424
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- TTAAATAAAATCAAAACTGGTACCTGTTTATACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATACGAGAAAAGACCTATCTTTGCAGCCATAAACTCGGTGGGAACACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	12518424	12565482	6	99.2	Perfect prediction

Length: 690 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BY84	100.0	Dual specificit...	Homo sapiens
BAB71060	99.8	unnamed protein...	Homo sapiens
AAI09235	99.8	Dual specificit...	Homo sapiens
XP_520751	99.4	dual specificit...	Pan troglodytes
AAH42101	99.5	DUSP16 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037719	3.4e-05	31.7	KIAA1298
AB051512	0.00095	27.2	KIAA1725

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008343	52	62	PR01764	MAP kinase phosphatase
	IPR008343	77	89	PR01764	MAP kinase phosphatase
	IPR008343	210	220	PR01764	MAP kinase phosphatase
	IPR008343	231	240	PR01764	MAP kinase phosphatase
	IPR008343	247	259	PR01764	MAP kinase phosphatase
HMMPfam	IPR001763	36	156	PF00581	Rhodanese-like
HMMPfam	IPR000340	183	322	PF00782	Protein-tyrosine phosphatase
HMMSmart	IPR001763	37	159	SM00450	Rhodanese-like
HMMSmart	IPR000340	183	322	SM00195	Protein-tyrosine phosphatase
ProfileScan	IPR001763	47	162	PS50206	Rhodanese-like
	IPR000340	183	324	PS50054	Protein-tyrosine phosphatase
	IPR000387	252	306	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	267	279	PS00383	Protein-tyrosine phosphatase

Primer_f	TCTCTTCAGCATGTAATTGGG
Primer_r	TTCAACAGCTGGCCTTACTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-