Gene/Protein Characteristic Table for KIAA1701
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00890
Accession No AB051488
Description basic helix-loop-helix domain containing, class B, 9, transcript variant 2
Clone name fj15383
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3827 bp)
Predicted protein sequence (570 aa)
Flexi ORF Clone FXC00890
Source Human fetal brain
Rouge ID mKIAA1701 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3827 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1800 bp
Genome contig ID gi89161218f_101789410
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACATCTTTGCATGTCAATAAATATGCCTCTACAAC
Flanking genome sequence
(104614 - 104663)
----+----*----+----*----+----*----+----*----+----*
ATATTTTTGAATCACTTAATATTTTTCCCATGTTAACAGTTGGTATATAG
Features of the protein sequence
Description

Length: 570 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q6PI77 4.9e-214 100.0 Protein BHLHB9;...
Homo sapiens
XP_001083873 1.5e-208 97.4 similar to basi...
Macaca mulatta
Q9BE11 5.3e-208 97.1 Protein BHLHB9;...
Macaca fascicularis
XP_538118 3.3e-154 78.7 similar to basi...
Canis lupus fam...
XP_001788041 2.9e-149 73.5 similar to basi...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB007903 3.1e-35 29.6 KIAA0443
AB011084 1.1e-11 22.3 KIAA0512
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006911 325 567 PF04826 Protein of unknown function DUF634
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCATTCCCAGGACATTTAGG
Primer_r TATACAGTGGGGGGAAGCAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp