KIAA0528

Product ID	ORK00093
Accession No	AB011100
Description	C2 calcium-dependent domain containing 5, transcript variant 6
Clone name	fj15856
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4186 bp) Predicted protein sequence (1003 aa)
HaloTag ORF Clone	FHC00093
Flexi ORF Clone	FXC00093
Source	Human fetal brain
Rouge ID	mKIAA0528 by Kazusa Mouse cDNA Project
Note	We replaced hg02576, former representative clones for KIAA0528 with fj15856. (2000/1/08)

Length: 4186 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1174 bp
Genome contig ID	gi89161190r_22392843
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TAATTTTATTTTTTAAATAAAAAGTGTATAAAAAT
Flanking genome sequence (99944 - 99895)	----+--------+--------+--------+--------+----* AAACTGGAATATTCCTAAATCTCTTTTTTACCTCCATCATATACTACTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	22492787	22588360	24	99.6	Perfect prediction

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001147809	99.8	hypothetical pr...	Pan troglodytes
XP_534864	98.7	similar to CG64...	Canis lupus fam...
NP_001125095	98.3	hypothetical pr...	Pongo abelii
XP_866129	97.9	similar to CG64...	Canis lupus fam...
NP_084173	96.2	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011110	0.00015	22.2	KIAA0538

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	24	36	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	48	61	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	73	81	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	8	93	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	7	108	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	1	93	PS50004	C2 calcium-dependent membrane targeting

Primer_f	GAACCGTAGCAAAGATGGAAC
Primer_r	ACTTTTCTCCATTGTCCCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAACCGTAGCAAAGATGGAAC
Primer_r	ACTTTTCTCCATTGTCCCCAC
PCR product length	198 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles