KIAA1702

Gene/Protein Characteristic Table for KIAA1702

Order Kazusa clone(s) from :

Product ID	ORK07476
Accession No	AB051489
Description	zinc finger protein 451
Clone name	fj15966
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4380 bp) Predicted protein sequence (530 aa)
Source	Human fetal brain
Rouge ID	mKIAA1702 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4380 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2504 bp
Genome contig ID	gi89161210f_56972978
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCTTCCCCTTCCCTTTGCCTTTTAAATTGTGGTT
Flanking genome sequence (104384 - 104433)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAAAAAGGCACATAAAGCTGAGCACCTTAACCATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	57072978	57077360	1	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX04473	8.4e-197	100.0	hCG1737847 [Hom...	Homo sapiens
CAH71222	1e-194	99.8	zinc finger pro...	Homo sapiens
XP_001110436	2.7e-192	99.2	hypothetical pr...	Macaca mulatta
AAH19546	2e-174	89.4	Zfp451 protein ...	Mus musculus
BAB29981	1.8e-152	88.3	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR002114	408	423	PS00589	Phosphotransferase system

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTCCATGCCAGTGTTCTCTAC
Primer_r	TCCAGTGGCAAGTCCTCTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 6

Experimental conditions

Panel name	CCR
Primer_f	GTCCATGCCAGTGTTCTCTAC
Primer_r	TCCAGTGGCAAGTCCTCTAAG
PCR product length	188 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp