Gene/Protein Characteristic Table for KIAA1704
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00891
Accession No AB051491
Description GPALPP motifs containing 1
Clone name fj16938
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4030 bp)
Predicted protein sequence (351 aa)
Flexi ORF Clone FXC00891
Source Human fetal brain
Rouge ID mKIAA1704 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4030 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2972 bp
Genome contig ID gi51511729f_44361755
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTTTTTATGTATAAATAAAGTTTTATCTATATCTG
Flanking genome sequence
(143989 - 144038)
----+----*----+----*----+----*----+----*----+----*
AGAAGTTGTAGTATTTATTTTTGTTTTAACATTATTAGCTTTTCTGAAGC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 13 f 44461755 44505742 12 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 351 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE89642 1.3e-108 97.7 unnamed protein...
Macaca fascicularis
XP_001094145 2.6e-108 97.1 similar to F26A...
Macaca mulatta
BAE88065 8.6e-108 96.8 unnamed protein...
Macaca fascicularis
XP_851499 8.6e-102 91.9 similar to CG33...
Canis lupus fam...
XP_001363803 2.1e-89 81.7 similar to pol ...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTGCTTCCAGGAGTTACTACC
Primer_r TCCGTCCTGTGCAATAACTAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp