Order Kazusa clone(s) from : ![]() |
Product ID | ORK00892 |
---|---|
Accession No | AB051493 |
Description | endonuclease/exonuclease/phosphatase family domain containing 1 |
Clone name | fj17179 |
Vector information | |
cDNA sequence | DNA sequence (4427 bp) Predicted protein sequence (573 aa) |
HaloTag ORF Clone |
FHC00892
![]() |
Flexi ORF Clone | FXC00892 |
Source | Human fetal brain |
Rouge ID |
mKIAA1706
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2336 bp |
---|---|
Genome contig ID | gi89161213f_36059620 |
PolyA signal sequence (ATTAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (248058 - 248107) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 36159620 | 36307676 | 8 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000445 | 42 | 71 | PF00633 | Helix-hairpin-helix motif |
IPR005135 | 265 | 542 | PF03372 | Endonuclease/exonuclease/phosphatase | |
HMMSmart | IPR003583 | 52 | 71 | SM00278 | Helix-hairpin-helix DNA-binding |
IPR003583 | 82 | 101 | SM00278 | Helix-hairpin-helix DNA-binding | |
IPR003583 | 149 | 168 | SM00278 | Helix-hairpin-helix DNA-binding | |
HMMTigr | IPR004509 | 42 | 104 | TIGR00426 | Competence protein ComEA helix-hairpin-helix region |
![]() |
Primer_f | ACCCTTGTTAACCTTCACCTG |
---|---|
Primer_r | TCATAGTCATTGCTGTCTGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |