KIAA1795

Product ID	ORK00280
Accession No	AB058698
Description	ligand dependent nuclear receptor corepressor, transcript variant 1
Clone name	fj17734
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4747 bp) Predicted protein sequence (572 aa)
HaloTag ORF Clone	FHC00280
Flexi ORF Clone	FXC00280
Source	Human fetal brain
Rouge ID	mKIAA1795 by Kazusa Mouse cDNA Project

Length: 4747 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2969 bp
Genome contig ID	gi89161187f_98482789
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCTAGTGGTCCCTTTTGAATTTCATGAGCCTCTC
Flanking genome sequence (225851 - 225900)	----+--------+--------+--------+--------+----* AAAAAAGAAAAACTTAAAAAAAAAAAAAAAAAAAAACAAAAAGCTGCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	98582789	98708638	8	100.0	Perfect prediction

Length: 572 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_543946	2.4e-199	99.3	similar to liga...	Canis lupus fam...
XP_001093998	7.2e-190	98.7	similar to liga...	Macaca mulatta
XP_345034	6.4e-188	93.9	similar to Mblk...	Rattus norvegicus
XP_001054322	6.8e-188	93.9	similar to Mblk...	Rattus norvegicus
Q96JN0	1.5e-157	100.0	Ligand-dependen...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007889	489	534	PF05225	Helix-turn-helix
ProfileScan	IPR011526	479	531	PS50960	Helix-turn-helix

Primer_f	CAGGGAAGGTTTTGGACACTC
Primer_r	ACTCGTAATGTGGTTTTGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAGGTCCAGATATTTCCAAGG
Primer_r	GGAACCCACACCCAAGCTATG
PCR product length	171 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles