KIAA1712

Gene/Protein Characteristic Table for KIAA1712

Order Kazusa clone(s) from :

Product ID	ORK00895
Accession No	AB051499
Description	centrosomal protein 44kDa, transcript variant 1
Clone name	fj18794
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4283 bp) Predicted protein sequence (391 aa)
HaloTag ORF Clone	FHC00895
Flexi ORF Clone	FXC00895
Source	Human fetal brain
Rouge ID	mKIAA1712 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4283 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2939 bp
Genome contig ID	gi89161207f_175355691
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AATATATTTTAAAAATAAAACTTGAAAACGTTGGG
Flanking genome sequence (122367 - 122416)	----+--------+--------+--------+--------+----* ACTTTGTTTCATGCCATTCATTACTCATAACTTTATATAATTGATACACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	175441646	175478056	12	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001086282	5.2e-141	94.4	hypothetical pr...	Macaca mulatta
BAF85173	9.6e-137	100.0	unnamed protein...	Homo sapiens
XP_001086406	1.9e-134	94.1	hypothetical pr...	Macaca mulatta
XP_001086517	2e-129	93.9	hypothetical pr...	Macaca mulatta
EDL28606	1.4e-90	67.3	cDNA sequence B...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GAAGAGATTACCTAGAGCTAC
Primer_r	TTACCGAGACCTATTCAGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 4

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp