KIAA1797

Product ID	ORK05712
Accession No	AB058700
Description	focadhesin
Clone name	fj20494
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4195 bp) Predicted protein sequence (1281 aa)
Source	Human fetal brain
Rouge ID	mKIAA1797 by Kazusa Mouse cDNA Project

Length: 4195 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	319 bp
Genome contig ID	gi89161216f_20710293
PolyA signal sequence (AGTAAA,-17)	+--------+--------+----*----+---- TTCTCCCTGCTAAATTCCAGTAAAATAATGTTGTC
Flanking genome sequence (275656 - 275705)	----+--------+--------+--------+--------+----* AATTTTGTGCGTGTGACTTTTGTTTTAAGGCATGGGGGAAGGTGCCAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	20810293	20985947	32	99.9	Perfect prediction

Length: 1281 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAN17740	100.0	hypothetical pr...	Homo sapiens
XP_001151311	99.5	hypothetical pr...	Pan troglodytes
XP_001151382	99.5	hypothetical pr...	Pan troglodytes
XP_001151442	99.5	hypothetical pr...	Pan troglodytes
XP_538678	90.0	similar to CG35...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1145	ALDEALDFFLLIFATAVVAWADH	1167	PRIMARY	23

Primer_f	ACTCTCCTTCCCAATAGCATG
Primer_r	AGAACTCTCAAGGACAGCAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-