KIAA1804

Gene/Protein Characteristic Table for KIAA1804

Order Kazusa clone(s) from :

Product ID	ORK06005
Accession No	AB058707
Description	mixed lineage kinase 4 (KIAA1804)
Clone name	fj22769
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4007 bp) Predicted protein sequence (490 aa)
Source	Human fetal brain
Rouge ID	mKIAA1804 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4007 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2438 bp
Genome contig ID	gi89161185f_231478152
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- TTAATAAACTTTTATAGCTGGTCTATTTGCTCAGT
Flanking genome sequence (109366 - 109415)	----+--------+--------+--------+--------+----* AGCTTTGATCCTCTCTTGATTATTGTGACTATAGTTTGCAATGGTTTATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	231578152	231587516	4	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI23047	6.7e-175	100.0	mitogen-activat...	Homo sapiens
Q5TCX8	7.4e-173	99.8	Mitogen-activat...	Homo sapiens
CAC84640	9.2e-170	98.3	mixed lineage k...	Homo sapiens
XP_001103092	2e-156	91.8	mixed lineage k...	Macaca mulatta
XP_001492336	3.8e-117	71.0	similar to mixe...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TTGCCGTCTTCCTTCCTACAG
Primer_r	AGTGGCTGAGATAATAGTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp