KIAA1933

Gene/Protein Characteristic Table for KIAA1933

Order Kazusa clone(s) from :

Product ID	ORK06493
Accession No	AB067520
Description	protein arginine methyltransferase 7
Clone name	fk00541
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3567 bp) Predicted protein sequence (500 aa)
Source	Human fetal brain
Rouge ID	mKIAA1933 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3567 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1364 bp
Genome contig ID	gi51511732f_66815615
PolyA signal sequence (AATACA,-12)	+--------+--------+----*----+---- CATGAAGATACAATACAGAAAAAAATACAGAAATT
Flanking genome sequence (134354 - 134403)	----+--------+--------+--------+--------+----* AAAAAAGTTTTTATAACAGTATTTCTAAATCTCAGCAAGTTAAAAAGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	66915387	66949967	11	99.5	Internal No-hit

Features of the protein sequence

Description

Length: 500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW83228	1.1e-216	100.0	protein arginin...	Homo sapiens
XP_863705	2.6e-196	86.5	similar to Prot...	Canis lupus fam...
EAW83232	1.3e-102	64.7	protein arginin...	Homo sapiens
BAB14215	1.3e-102	85.6	unnamed protein...	Homo sapiens
EAW83226	1.3e-102	85.7	protein arginin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGCTTCTCTCACACACTAACC
Primer_r	ACACCGGAACTCTGCTCATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp