KIAA1886

Product ID	ORK07432
Accession No	AB067473
Description	zinc finger, MIZ-type containing 2
Clone name	fk01837
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2883 bp) Predicted protein sequence (655 aa)
Source	Human fetal brain

Length: 2883 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	913 bp
Genome contig ID	gi89161213f_44664135
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTGAAGAATTAGTACAGCTGTGTTTTTTAAAGCC
Flanking genome sequence (110527 - 110576)	----+--------+--------+--------+--------+----* ACCTCTCTGTCTCCACCCCATGGGCCCACACCCAGGTGGGGGAGGAGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	44764135	44774660	13	99.9	Perfect prediction

Length: 655 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAR85526	1.2e-202	100.0	PIAS-like prote...	Homo sapiens
AAI10436	2.8e-202	99.8	ZMIZ2 protein [...	Homo sapiens
NP_777589	2.9e-202	99.8	zinc finger, MI...	Homo sapiens
XP_001147090	7.8e-202	99.4	hypothetical pr...	Pan troglodytes
XP_001147613	8.1e-202	99.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033050	1.1e-61	62.2	KIAA1224

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004181	331	380	PF02891	Zinc finger
ProfileScan	IPR004181	320	397	PS51044	Zinc finger

Primer_f	CTTGTCCAGCATTGATCCTTC
Primer_r	GAGAGGAACCTGACACCACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-