|
Order Kazusa clone(s) from : |
| Product ID | ORK00373 |
|---|---|
| Accession No | D25217 |
| Description | megalencephalic leukoencephalopathy with subcortical cysts 1, transcript variant 1 |
| Clone name | fk03155 |
| Vector information | |
| cDNA sequence | DNA sequence (3629 bp) Predicted protein sequence (418 aa) |
|
HaloTag ORF Clone |
FHC00373
|
| Flexi ORF Clone | FXC00373 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA0027
by Kazusa Mouse cDNA Project
|
| Note | We replaced ha00522, former representative clones for KIAA0027 with fk03155. (2002/5/10) |
Length: 3629 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 2185 bp |
|---|---|
| Genome contig ID | gi89161203r_48739954 |
| PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 22 | r | 48839954 | 48866161 | 12 | 99.4 | Perfect prediction |
Length: 418 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| ScanRegExp | IPR001209 | 125 | 147 | PS00527 | Ribosomal protein S14 |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 94 | VFSVLMGSCLLVTSGFSLYLGNV | 116 | PRIMARY | 23 | 2 | 121 | MDYLRCAAGSCIPSAIVSFTVS | 142 | SECONDARY | 22 | 3 | 151 | NFQILFVSTFAVTTTCLIWFGCK | 173 | PRIMARY | 23 | 4 | 184 | NFNLILLLLLELLMAATVIIAAR | 206 | PRIMARY | 23 | 5 | 240 | SVVEVIAGISAVLGGIIALNVDD | 262 | PRIMARY | 23 | 6 | 268 | HLSVTFFWILVACFPSAIASHVA | 290 | PRIMARY | 23 | 7 | 302 | LIAISSLTSPLLFTASGYLSFSI | 324 | PRIMARY | 23 | 8 | 338 | IKPSYDVLLLLLLLVLLLQAGLN | 360 | PRIMARY | 23 |
|---|
Chromosome No. 22
Experimental conditions| Panel name | Genebridge 4 |
|---|---|
| Primer_f | TCAGGGGCCGGGCAAACACT |
| Primer_r | CTCAAAGCTGCAGGGAGGTG |
| PCR product length | 363 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |