Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00373 |
---|---|
Accession No | D25217 |
Description | megalencephalic leukoencephalopathy with subcortical cysts 1, transcript variant 1 |
Clone name | fk03155 |
Vector information | |
cDNA sequence | DNA sequence (3629 bp) Predicted protein sequence (418 aa) |
HaloTag ORF Clone |
FHC00373
|
Flexi ORF Clone | FXC00373 |
Source | Human fetal brain |
Rouge ID |
mKIAA0027
by Kazusa Mouse cDNA Project
|
Note | We replaced ha00522, former representative clones for KIAA0027 with fk03155. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2185 bp |
---|---|
Genome contig ID | gi89161203r_48739954 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | r | 48839954 | 48866161 | 12 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR001209 | 125 | 147 | PS00527 | Ribosomal protein S14 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 94 | VFSVLMGSCLLVTSGFSLYLGNV | 116 | PRIMARY | 23 | 2 | 121 | MDYLRCAAGSCIPSAIVSFTVS | 142 | SECONDARY | 22 | 3 | 151 | NFQILFVSTFAVTTTCLIWFGCK | 173 | PRIMARY | 23 | 4 | 184 | NFNLILLLLLELLMAATVIIAAR | 206 | PRIMARY | 23 | 5 | 240 | SVVEVIAGISAVLGGIIALNVDD | 262 | PRIMARY | 23 | 6 | 268 | HLSVTFFWILVACFPSAIASHVA | 290 | PRIMARY | 23 | 7 | 302 | LIAISSLTSPLLFTASGYLSFSI | 324 | PRIMARY | 23 | 8 | 338 | IKPSYDVLLLLLLLVLLLQAGLN | 360 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | TCAGGGGCCGGGCAAACACT |
Primer_r | CTCAAAGCTGCAGGGAGGTG |
PCR product length | 363 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |