Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00924 |
---|---|
Accession No | AB058713 |
Description | synovial apoptosis inhibitor 1, synoviolin |
Clone name | fk03376 |
Vector information | |
cDNA sequence | DNA sequence (2841 bp) Predicted protein sequence (579 aa) |
HaloTag ORF Clone |
FHC00924
|
Flexi ORF Clone | FXC00924 |
Source | Human fetal brain |
Rouge ID |
mKIAA1810
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1101 bp |
---|---|
Genome contig ID | gi51511727r_64551329 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 64651329 | 64658527 | 14 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | NULL | 302 | 323 | PR01217 | NULL |
NULL | 323 | 339 | PR01217 | NULL | |
NULL | 348 | 365 | PR01217 | NULL | |
NULL | 419 | 444 | PR01217 | NULL | |
HMMPfam | IPR001841 | 254 | 292 | PF00097 | Zinc finger |
HMMSmart | IPR001841 | 254 | 292 | SM00184 | Zinc finger |
ProfileScan | IPR001841 | 254 | 293 | PS50089 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 16 | FRTAVMMAASLALTGAVVAHAYY | 38 | PRIMARY | 23 | 2 | 54 | SPSMAVLYIQAFVLVFLLGKVMG | 76 | PRIMARY | 23 | 3 | 139 | DFYAILMTMVLTIFIKYVLHSVD | 161 | SECONDARY | 23 | 4 | 182 | TGFIKVLLYMAFMTIMIKVHTFP | 204 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CCTTCCTCTCCAACTCTTCAG |
---|---|
Primer_r | TGGGAACGGGAGCTAATACTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |