Gene/Protein Characteristic Table for KIAA1892
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00942
Accession No AB067479
Description DDB1 and CUL4 associated factor 12
Clone name fk04164
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3591 bp)
Predicted protein sequence (476 aa)
Flexi ORF Clone FXC00942
Source Human fetal brain
Rouge ID mKIAA1892 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3591 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1967 bp
Genome contig ID gi89161216r_33976411
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTGCCAAGGAAAAAAATAAAAATTATTCCAGTGC
Flanking genome sequence
(99975 - 99926)
----+----*----+----*----+----*----+----*----+----*
ACAATGGTGTGAGTGAGTATTGTGTAGCCAGGAGCCTGCCAAAAAGGCCC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 9 r 34076386 34116691 9 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 476 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5T6F0 1.4e-200 100.0 WD repeat-conta...
Homo sapiens
AAH63823 3.5e-200 99.8 WD repeat domai...
Homo sapiens
XP_538706 3.1e-199 99.3 similar to WD r...
Canis lupus fam...
Q4R3J7 6.7e-199 99.1 WD repeat-conta...
Macaca fascicularis
XP_001098592 1.7e-198 98.9 similar to WD r...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 196 234 PF00400 WD40 repeat
HMMSmart IPR001680 100 139 SM00320 WD40 repeat
IPR001680 195 234 SM00320 WD40 repeat
IPR001680 259 303 SM00320 WD40 repeat
IPR001680 351 389 SM00320 WD40 repeat
ProfileScan IPR001680 203 243 PS50082 WD40 repeat
IPR001680 203 243 PS50294 WD40 repeat
ScanRegExp IPR001680 221 235 PS00678 WD40 repeat
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTCTGCTTTTCTGTCAACATC
Primer_r CTGTGGTATGTGCTGTGTAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp