KIAA1893

Gene/Protein Characteristic Table for KIAA1893

Order Kazusa clone(s) from :

Product ID	ORK00296
Accession No	AB067480
Description	G protein regulated inducer of neurite outgrowth 1
Clone name	fk04261
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3517 bp) Predicted protein sequence (800 aa)
HaloTag ORF Clone	FHC00296
Flexi ORF Clone	FXC00296
Source	Human fetal brain
Rouge ID	mKIAA1893 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3517 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	936 bp
Genome contig ID	gi51511721r_175855411
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TGTCACAGTATACATTGGTAATAAAATATTTCCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCCTGTCTGCCGTGATTGGCCAAAAGCAGGAGGCAGGGCAGCGTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	175955411	175969743	3	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 800 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11369	0	100.0	G protein-regul...	synthetic construct
EAW85065	0	96.1	G protein-regul...	Homo sapiens
Q7Z2K8	0	96.1	G protein-regul...	Homo sapiens
XP_001085023	9.2e-200	90.2	similar to G pr...	Macaca mulatta
CAD38868	1.9e-160	93.6	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTCTATAGGTAAAGTGGTCTC
Primer_r	ATCCGCCTTTGTGGTGGTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 5

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp