KIAA1895

Gene/Protein Characteristic Table for KIAA1895

Order Kazusa clone(s) from :

Product ID	ORK00943
Accession No	AB067482
Description	family with sequence similarity 111, member A, transcript variant 1
Clone name	fk05638
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3992 bp) Predicted protein sequence (628 aa)
HaloTag ORF Clone	FHC00943
Flexi ORF Clone	FXC00943
Source	Human fetal brain
Rouge ID	mKIAA1895 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3992 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1528 bp
Genome contig ID	gi51511727f_58572294
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TGTTTGTAAGTTCCTATTAAATGTTTCTTTCTGAG
Flanking genome sequence (106793 - 106842)	----+--------+--------+--------+--------+----* AAACCGTATTTGTCAGCCTCTTTCTTTGGCCTCTCAGCTTCTTTGGTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	58672294	58679085	2	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 628 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PZ2	0	100.0	Protein FAM111A.	Homo sapiens
AAH71759	0	99.8	FAM111A protein...	Homo sapiens
XP_001090771	0	89.7	hypothetical pr...	Macaca mulatta
AAH13137	2.1e-175	100.0	FAM111A protein...	Homo sapiens
XP_852330	1e-143	62.7	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTACAGTGCAGGAACCAAAAC
Primer_r	AAGACCCATATATTCCGACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 11

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp