KIAA1914

Gene/Protein Characteristic Table for KIAA1914

Order Kazusa clone(s) from :

Product ID	ORK04061
Accession No	AB067501
Description	actin filament associated protein 1-like 2
Clone name	fk06306
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3700 bp) Predicted protein sequence (460 aa)
Source	Human fetal brain
Rouge ID	mKIAA1914 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3700 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2094 bp
Genome contig ID	gi89161187r_115944575
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAGGTTTTTTAAAATAAAATGTTCATTGTATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTTTTCCTCAGTTCATGAAATGACTTGGGGCAGGGCCTGGGGGGTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	116044575	116051766	6	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 460 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH11936	3.2e-110	96.3	unnamed protein...	Homo sapiens
BAF84401	9.4e-110	96.0	unnamed protein...	Homo sapiens
AAQ05765	1.2e-109	95.7	XB130 [Homo sap...	Homo sapiens
BAH12099	5.1e-108	95.1	unnamed protein...	Homo sapiens
BAG53870	9.1e-108	95.1	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAGGAAATTGACGAGGAGTGC
Primer_r	GAGTGTGGTTGCAGAGTTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp